Error in RNA::HairpinFigure causes broken tests

[greatfireball]

It seems, that RNA::HairpinFigure has a problem to generate correct hairpin structures. In some cases, the output sequence is wrong. Therefore, tests are failing, due to wrong nucleotids inside the structure.

[greatfireball]

Currently, this blocks the tests of push requests #135 and #136, which should solve #135

[greatfireball]

Example case is here:

perl -MRNA::HairpinFigure -e '
$seq="UUCGCGAGUUCCGUGCUUCCUUACUUCCCAUAGUGCUUUAAACGUAUGGAAUGUAAAGAAGUAUGGAGCGAA";
$str=".......((((((((((((.((((...(((((((.......)).)))))...)))).))))))))))))...";
print draw($seq, $str),"\n"; '                                                                                                                                                                                          
UUCGCGA            C    UUC     -  GC                                                                                                                                                         
       GUUCCGUGCUUC UUAC   CCAUA GU  U                                                                                                                                                        
       |||||||||||| ||||   ||||| ||  U                                                                                                                                                        
       CGAGGUAUGAAG AAUG   GGUAU CA  A                                                                                                                                                        
----AAG            A    UAA     G  AA 

The sequence should contain an U inside the lower right corner and not an A.

[greatfireball]

Possible solutions to the problems include:

1. Fixing the RNA::HairpinFigure issue and using a fixed version
2. Ignoring the sequence information and substitute the information using the sequence
3. Ignoring the structure if miraligner does not require it.